blunt end cloning vector pjet1 2 (Addgene inc)

Addgene inc is a verified supplier

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Addgene inc blunt end cloning vector pjet1 2
Blunt End Cloning Vector Pjet1 2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pcdna3/NHR1-Flag+pcDNA3%2E1+(Plasmid+%2317315)/pmc12804166-56-8-12
Average 94 stars, based on 2 article reviews

blunt end cloning vector pjet1 2 - by Bioz Stars, 2026-09

94/100 stars

Images

Expressing:

Article Title: Structural Basis for the Recruitment and Selective Phosphorylation of Akt by mTORC2
Article Snippet: .. Flag-PKN1 (WT and S916A) expression plasmids were gifts from Bryce Paschal. cDNAs containing human Akt1 were in pcDNA3 for mammalian expression (Addgene, # 9021) or with C-terminal MxeIntein-CBD in pFastbac1 as described( 24 ). .. To generate point mutants and truncations of cDNAs for structural validation, site-directed mutagenesis reactions were performed using a two-stage QuikChange protocol( 68 ) using PfuUltra-II HS polymerase, by the Q5 Site-Directed Mutagenesis strategy (NEB), or by multichange isothermal assembly( 69 ).

Article Title: Pathogenic tau inhibits synaptic plasticity by blocking eIF4B-mediated local protein synthesis
Article Snippet: .. For expression in dissociated hippocampal neurons, pcDNA3.1 5’-myrdEGFP-3’ plasmid was a gift from Dr. Erin Schuman (Addgene plasmid #16075) and a pGW1-mApple plasmid (gift from Dr. Steve Finkbeiner) was used. ..

Labeling:

Article Title: MUDENG, a component of adaptor complex 5, mediates TRAIL- and TMZ-triggered apoptosis in glioblastoma (GBM) via multiple pathways.
Article Snippet: chemotherapy with temozolomide (TMZ), yet patient outcomes remain poor due to intrinsic resistance mechanisms [2].. TMZ exerts cytotoxicity by inducing DNA damage, but over 50% of GBM tumors display resistance mediated by DNA repair pathways such as MGMT, BER, and MMR [3, 4].. Tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL) is a promising alternative therapy that activates caspase-8 and triggers both extrinsic and intrinsic apoptotic pathways.

Article Title: 4Pi-SIMFLUX: 4Pi single-molecule localization microscopy with structured illumination.
Article Snippet: Single-molecule localization microscopy (SMLM) has transformed biological imaging by enabling nanoscale visualization of intricate subcellular structures.. However, conventional three-dimensional SMLM techniques typically exhibit lower axial resolution than lateral resolution, hindering isotropic investigations.. Interferometric approaches, such as 4Pi-SMLM, enhance axial resolution by approximately fivefold through dual-objective coherent fluorescence detection, surpassing lateral resolution.

Plasmid Preparation:

Article Title: Mirror-enhanced 4Pi-SMLM with one objective enables isotropic nanoscale imaging.
Article Snippet: .. For microtubule labelling, oxStayGold-ALFA-Ensconsin was constructed by replacing the mEmerald sequence in mEmerald-Ensconsin with oxStayGold from pcDNA3/er-(n2)oxStayGold(c4) (Addgene, plasmid no. 185822) and inserting an ALFA tag at the N terminus of Ensconsin. ..

Article Title: CD16A Shedding Regulates Innate Cell Engager‐Induced Serial Killing by Natural Killer Cells
Article Snippet: NK92 cell lines were generated from NK92 WT (Cat. No. CRL‐2407, ATCC) as described in the supporting information and cultured in stem cell growth medium (SCGM, Cat. No. 20802‐0500, CellGenix) supplemented with 20% FBS, which was enriched with 300 U/mL IL‐2 every second day. .. To generate NK92 cells with high‐affinity (HA) or high‐affinity noncleavable (HA NC) CD16, the LeGO‐G2 plasmid (Cat.No.25917 Addgene) was modified by adding a multiple cloning site (MCS) from pcDNA3 (Cat. No.13032 Addgene), a T2A sequence, and a linker (amino acids GSGSGSG) in frame with downstream eGFP. ..

Article Title: PCSK5 M452I is a recessive hypomorph exclusive to MCF10DCIS.com cells
Article Snippet: Cells were confirmed negative for mycoplasma (R&D Systems, CUL001B) in May 2023 and were used within one month of thawing for all experiments. .. GDF11 secretion assay—pLX302 GDF11-V5 puro (RRID:Addgene_83097), pLX304 (wildtype) PCSK5-V5 blast (RRID:Addgene_83100), and pLX304 PCSK5 (T288P)-V5 blast (RRID:Addgene_83101) were described previously ( 28 ). pBabe GFP (RRID:Addgene_10668), pBabe puro HA PIK3CA H1047R (RRID:Addgene_12524), pHAGE GFP (RRID:Addgene_106281), and pHAGE PIK3CA H1047R (RRID:Addgene_116500) were commercially obtained. pDONR223 PCSK5 (M452I) (RRID:Addgene_232445) was prepared by QuikChange II XL site-directed mutagenesis (Agilent, 200521) of pDONR223 (wildtype) PCSK5 from the human ORFeome v5.1 and recombined into pLX304 (RRID:Addgene_25890) with LR clonase II (Invitrogen, 11791020) to yield pLX304 PCSK5 (M452I)-V5 blast (RRID:Addgene_232446). pDONR223 BMP2 and pDONR223 BMP4 from the human ORFeome v5.1 were similarly recombined into pLX302 (RRID:Addgene_25896) with LR clonase II (Invitrogen, 11791020) to yield pLX302 BMP2-V5 puro (RRID:Addgene_246525) and pLX302 BMP4-V5 puro (RRID:Addgene_246526). pcDNA3 was used as a carrier plasmid for lipofections, and pLX302 EGFP-V5 puro (RRID:Addgene_141348) or pLX304 EGFP-V5 blast (RRID:Addgene_232447) was used when diluting GDF11 or PCSK5 plasmid dosage and for negative controls. pcDNA3.1 HRAS (G12V) was kindly provided by David Kashatus. .. Knockout and addback of PCSK5 alleles—For PCSK5 knockout, an sgRNA sequence (sg09, CTACACGGGAAAGAACATTG) was cloned into EDCPV (RRID:Addgene_90085) by conventional restriction digest, oligo annealing, and ligation to yield EDCPV PCSK5_sg09 (RRID:Addgene_232455).

Construct:

Sequencing:

Modification:

Cloning:

Mutagenesis:

Article Title: Supplemental Materials A Small Molecular Bidentate-Binding Dual Inhibitor Probe of the LRRK2 and JNK3 Kinases
Article Snippet: Nuclei were stained with TO-PRO-3 iodide (642/661) (1:4000) for 30 minutes at RT, washed twice in PBS/0.05 % Tween-20 and read with an Odyssey Infrared Imaging System (LI-COR Biosciences). .. Plasmids and Mutagenesis: pCDNA3.1:LRRK2 was purchased from Addgene. .. Mutagenesis of pCDNA3.1:LRRK2 to create LRRK2:G2019S was performed using the Stratagene QuikChange site-directed mutagenesis kit protocol; primer designs for the individual mutants were derived using the QuikChange Primer Design software on the Stratagene website.

Review